Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1244615
End position: 1244641
Length: 27

DNA sequence
>NC_022576, from 1244615 to 1244641 (27 bp); Comamonadaceae bacterium CR CACCTCCATCACCTCGATCACCTCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1244610-1246325	Sequence	Cenrod_1147 - hypothetical protein (Protein is coded in complementary strand; from 1246325 to 1244610)