Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1169068
End position: 1169091
Length: 24

DNA sequence
>NC_022576, from 1169068 to 1169091 (24 bp); Comamonadaceae bacterium CR GCCACCGCCGCCGCCACCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1168958-1169377	Sequence	Cenrod_1079 - RNA-binding protein (Protein is coded in complementary strand; from 1169377 to 1168958)