Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1167698
End position: 1167724
Length: 27

DNA sequence
>NC_022576, from 1167698 to 1167724 (27 bp); Comamonadaceae bacterium CR CTGCTGCCTCTGCTGCCTCTGCTGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1167293-1167946	Sequence	Cenrod_1077 lptC lipopolysaccharide export system protein LptC