Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1051929
End position: 1051952
Length: 24

DNA sequence
>NC_022576, from 1051929 to 1051952 (24 bp); Comamonadaceae bacterium CR GCAGGAGCAGGAGCAGGAGCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1049181-1052402	Sequence	Cenrod_0983 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 1052402 to 1049181)