Sequence retrieval

Genome: Chlamydia trachomatis strain D/13-96
Start position: 651003
End position: 651038
Length: 36

DNA sequence
>NC_022119, from 651003 to 651038 (36 bp); Chlamydia trachomatis strain D/13-96 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650002-651465	Sequence	O176_03180 - type III secretion system membrane protein