Sequence retrieval

Genome: Chlamydia trachomatis strain D/13-96
Start position: 56565
End position: 56600
Length: 36

DNA sequence
>NC_022119, from 56565 to 56600 (36 bp); Chlamydia trachomatis strain D/13-96 TGGTGTAGGATCTGGGGTAGGAGCTTGTGTAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 55636-57315	Sequence	O176_00270 - hypothetical protein (Protein is coded in complementary strand; from 57315 to 55636)