Sequence retrieval

Genome: Chlamydia trachomatis strain D/14-96
Start position: 650952
End position: 650987
Length: 36

DNA sequence
>NC_022109, from 650952 to 650987 (36 bp); Chlamydia trachomatis strain D/14-96 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 649951-651414	Sequence	O177_03170 - type III secretion system membrane protein