Sequence retrieval

Genome: Acetobacter pasteurianus 386B
Start position: 2119257
End position: 2119319
Length: 63

DNA sequence
>NC_021991, from 2119257 to 2119319 (63 bp); Acetobacter pasteurianus 386B GGTGGCGAACATGGTGGCCCCGGTGGCGAACATGGCGGCCCGGGTGGTGAACACGGTGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2119033-2119338	Sequence	APA386B_2046 - hypothetical protein
ORF... 2119313-2119459	Sequence	APA386B_2047 - hypothetical protein