Sequence retrieval

Genome: Acetobacter pasteurianus 386B
Start position: 2118245
End position: 2118304
Length: 60

DNA sequence
>NC_021991, from 2118245 to 2118304 (60 bp); Acetobacter pasteurianus 386B GCCGGGTGCGGCGTATCCGGGTGCGGCATAACCGGGGGCAGCGTAGCCCGGTGCTGCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2118237-2118782	Sequence	APA386B_2045 - hypothetical protein (Protein is coded in complementary strand; from 2118782 to 2118237)