Sequence retrieval

Genome: Acetobacter pasteurianus 386B
Start position: 964786
End position: 964833
Length: 48

DNA sequence
>NC_021991, from 964786 to 964833 (48 bp); Acetobacter pasteurianus 386B CGGCGGTGGTGGCGGCGGTGGAGGTGGCGGCGGTGGCGGCTGAGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 964316-964903	Sequence	APA386B_931 - hypothetical protein (Protein is coded in complementary strand; from 964903 to 964316)