Sequence retrieval

Genome: Acetobacter pasteurianus 386B
Start position: 77484
End position: 77531
Length: 48

DNA sequence
>NC_021991, from 77484 to 77531 (48 bp); Acetobacter pasteurianus 386B CGGCGGTGGTGGCGGCGGTGGAGGTGGCGGCGGTGGCGGCTGAGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 77014-77724	Sequence	APA386B_137 - TonB periplasmic protein (Protein is coded in complementary strand; from 77724 to 77014)