Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 4478930
End position: 4478956
Length: 27

DNA sequence
>NC_021902, from 4478930 to 4478956 (27 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 TCGCCGCCGTCGCCGCCATCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4477889-4479061	Sequence	SN31241_44240 - GTPase obg (Protein is coded in complementary strand; from 4479061 to 4477889)