Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 3595878
End position: 3595907
Length: 30

DNA sequence
>NC_021902, from 3595878 to 3595907 (30 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3595020-3596207	Sequence	SN31241_35660 - Ethanolamine utilization protein EutG (Protein is coded in complementary strand; from 3596207 to 3595020)