Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1
Start position: 3378861
End position: 3378887
Length: 27

DNA sequence
>NC_021902, from 3378861 to 3378887 (27 bp); Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3378761-3378934	Sequence	SN31241_33550 - heme exporter protein D (Protein is coded in complementary strand; from 3378934 to 3378761)