Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 93922
End position: 93945
Length: 24

DNA sequence
>NC_021838, from 93922 to 93945 (24 bp); Listeria monocytogenes strain R2-502 CTCTTTTACTATTTTACTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 93931-94206	Sequence	M641_00635 - hypothetical protein (Protein is coded in complementary strand; from 94206 to 93931)