Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 8108
End position: 8140
Length: 33

DNA sequence
>NC_021838, from 8108 to 8140 (33 bp); Listeria monocytogenes strain R2-502 TGTTCGGTGGCTGTTCGGTGGCTGTTCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7603-8523	Sequence	M641_00085 - hypothetical protein (Protein is coded in complementary strand; from 8523 to 7603)