Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 784922
End position: 784975
Length: 54

DNA sequence
>NC_021838, from 784922 to 784975 (54 bp); Listeria monocytogenes strain R2-502 GGGTCAACTGGATCAACCGGATTTACTGGATCAACCGGGTCAACTGGATTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 784736-786001	Sequence	M641_04175 - peptidoglycan-binding protein (Protein is coded in complementary strand; from 786001 to 784736)