Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 396068
End position: 396100
Length: 33

DNA sequence
>NC_021838, from 396068 to 396100 (33 bp); Listeria monocytogenes strain R2-502 TTTGCTTTTGATTTGTTTTTTATTTACTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 395304-396701	Sequence	M641_02270 - deoxyguanosinetriphosphate triphosphohydrolase (Protein is coded in complementary strand; from 396701 to 395304)