Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 35308
End position: 35337
Length: 30

DNA sequence
>NC_021838, from 35308 to 35337 (30 bp); Listeria monocytogenes strain R2-502 CTTTTTCATCCTTTTTCCCCCTTTTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 34508-35317	Sequence	M641_00275 - L-cystine-binding protein tcyJ (Protein is coded in complementary strand; from 35317 to 34508)
ORF... 35334-35870	Sequence	M641_00280 - acetyltransferase (Protein is coded in complementary strand; from 35870 to 35334)