Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 321153
End position: 321182
Length: 30

DNA sequence
>NC_021838, from 321153 to 321182 (30 bp); Listeria monocytogenes strain R2-502 ATTTTAGTTAATTTTTGTGACTTTTCGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 321161-321370	Sequence	M641_01825 - hypothetical protein (Protein is coded in complementary strand; from 321370 to 321161)