Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 27620
End position: 27643
Length: 24

DNA sequence
>NC_021838, from 27620 to 27643 (24 bp); Listeria monocytogenes strain R2-502 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 26770-27681	Sequence	M641_00230 - pseudouridine-5'-phosphate glycosidase (Protein is coded in complementary strand; from 27681 to 26770)