Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 2509062
End position: 2509097
Length: 36

DNA sequence
>NC_021838, from 2509062 to 2509097 (36 bp); Listeria monocytogenes strain R2-502 GCATCCGCATCAGCATCCGCATCAGCATCCGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2508801-2511272	Sequence	M641_12880 - hypothetical protein (Protein is coded in complementary strand; from 2511272 to 2508801)