Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 2428750
End position: 2428779
Length: 30

DNA sequence
>NC_021838, from 2428750 to 2428779 (30 bp); Listeria monocytogenes strain R2-502 AATAAGGAAAATAAAGGAAAAATCTGGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2427266-2429152	Sequence	M641_12450 - transporter (Protein is coded in complementary strand; from 2429152 to 2427266)