Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 2184464
End position: 2184490
Length: 27

DNA sequence
>NC_021838, from 2184464 to 2184490 (27 bp); Listeria monocytogenes strain R2-502 TTTTTCTGCTTTATCTGCTTTTTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2184342-2186171	Sequence	M641_11280 - cell wall surface anchor protein (Protein is coded in complementary strand; from 2186171 to 2184342)