Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 2136997
End position: 2137041
Length: 45

DNA sequence
>NC_021838, from 2136997 to 2137041 (45 bp); Listeria monocytogenes strain R2-502 TAACTGGGTCTGGATCAACTGGATCTGGATTTACTGGATCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2136354-2137196	Sequence	M641_11065 - hypothetical protein (Protein is coded in complementary strand; from 2137196 to 2136354)