Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 1847081
End position: 1847134
Length: 54

DNA sequence
>NC_021838, from 1847081 to 1847134 (54 bp); Listeria monocytogenes strain R2-502 GGTTTTATAGGTTTTATAGGTTTTATAGGTTTTATAGGTTTTATAGGTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1846856-1852984	Sequence	M641_09645 - cell wall surface anchor protein (Protein is coded in complementary strand; from 1852984 to 1846856)