Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 1627799
End position: 1627822
Length: 24

DNA sequence
>NC_021838, from 1627799 to 1627822 (24 bp); Listeria monocytogenes strain R2-502 GTTTTTGCTTTTCTTTTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1627591-1628592	Sequence	M641_08450 - sugar ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1628592 to 1627591)