Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 1576937
End position: 1577008
Length: 72

DNA sequence
>NC_021838, from 1576937 to 1577008 (72 bp); Listeria monocytogenes strain R2-502 TCTACCGGATCTACCGGATCTACCGGATCTACCGGATCTACCGGATCTACCGGATCTACCGGATCTACCG GA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1576673-1578199	Sequence	M641_08180 - cell wall surface anchor protein (Protein is coded in complementary strand; from 1578199 to 1576673)