Sequence retrieval

Genome: Listeria monocytogenes strain R2-502
Start position: 2740458
End position: 2740490
Length: 33

DNA sequence
>NC_021838, from 2740458 to 2740490 (33 bp); Listeria monocytogenes strain R2-502 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2740138-2740665	Sequence	M641_13960 - septum formation initiator (Protein is coded in complementary strand; from 2740665 to 2740138)