Sequence retrieval

Genome: Listeria monocytogenes J1816
Start position: 2777565
End position: 2777612
Length: 48

DNA sequence
>NC_021829, from 2777565 to 2777612 (48 bp); Listeria monocytogenes J1816 TTGGTGTTGGATTTGGCGTCGGATCTGGTGTTGGATTTGGCGTTGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2777330-2779150	Sequence	LM1816_15107 - peptidoglycan-binding protein (Protein is coded in complementary strand; from 2779150 to 2777330)