Sequence retrieval

Genome: Listeria monocytogenes J1816
Start position: 545192
End position: 545236
Length: 45

DNA sequence
>NC_021829, from 545192 to 545236 (45 bp); Listeria monocytogenes J1816 TAACTGGGTCTGGATCAACTGGATCTGGATTTACTGGATCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 544549-545391	Sequence	LM1816_11037 - hypothetical protein (Protein is coded in complementary strand; from 545391 to 544549)