Sequence retrieval

Genome: Listeria monocytogenes J1816
Start position: 839619
End position: 839648
Length: 30

DNA sequence
>NC_021829, from 839619 to 839648 (30 bp); Listeria monocytogenes J1816 AATAAGGAAAATAAAGGAAAAATCTGGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 838135-840021	Sequence	LM1816_09080 - transporter (Protein is coded in complementary strand; from 840021 to 838135)