Sequence retrieval

Genome: Listeria monocytogenes J1816
Start position: 584095
End position: 584121
Length: 27

DNA sequence
>NC_021829, from 584095 to 584121 (27 bp); Listeria monocytogenes J1816 TTTTTCTGCTTTATCTGCTTTTTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 583973-585802	Sequence	LM1816_10837 - cell wall surface anchor protein (Protein is coded in complementary strand; from 585802 to 583973)