Sequence retrieval

Genome: Mannheimia haemolytica D153
Start position: 613954
End position: 614013
Length: 60

DNA sequence
>NC_021743, from 613954 to 614013 (60 bp); Mannheimia haemolytica D153 CAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 613760-615661	Sequence	F382_03170 - type I restriction endonuclease HindVIIP subunit M