Sequence retrieval

Genome: Mannheimia haemolytica D153
Start position: 257168
End position: 257195
Length: 28

DNA sequence
>NC_021743, from 257168 to 257195 (28 bp); Mannheimia haemolytica D153 GCTGTCGGCTGTCGGCTGTCGGCTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 256248-257228	Sequence	F382_01430 - hypothetical protein (Protein is coded in complementary strand; from 257228 to 256248)