Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 99966
End position: 99989
Length: 24

DNA sequence
>NC_021658, from 99966 to 99989 (24 bp); Sorangium cellulosum So0157-2 ACCGCGACCGCAGCCGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 99567-100094	Sequence	SCE1572_00315 - hypothetical protein (Protein is coded in complementary strand; from 100094 to 99567)