Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9958398
End position: 9958424
Length: 27

DNA sequence
>NC_021658, from 9958398 to 9958424 (27 bp); Sorangium cellulosum So0157-2 GGCGGCGCGGCCGGCGCGGGCGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9957182-9958447	Sequence	SCE1572_35050 - hypothetical protein (Protein is coded in complementary strand; from 9958447 to 9957182)