Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9909469
End position: 9909492
Length: 24

DNA sequence
>NC_021658, from 9909469 to 9909492 (24 bp); Sorangium cellulosum So0157-2 GCCGGCGGCGGCGCCGACGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9908600-9909679	Sequence	SCE1572_34850 - hypothetical protein (Protein is coded in complementary strand; from 9909679 to 9908600)