Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9870582
End position: 9870641
Length: 60

DNA sequence
>NC_021658, from 9870582 to 9870641 (60 bp); Sorangium cellulosum So0157-2 CCGCCGTCGCCGGCGCCGCCGTCGCCGCCGACGCCGTCGCCGGCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9869736-9870740	Sequence	SCE1572_34710 - hypothetical protein (Protein is coded in complementary strand; from 9870740 to 9869736)