Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9869542
End position: 9869577
Length: 36

DNA sequence
>NC_021658, from 9869542 to 9869577 (36 bp); Sorangium cellulosum So0157-2 CCCCCGTCGCTCCCCCCGTCGCTCCCCCCGTCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9868456-9869730	Sequence	SCE1572_34705 - cytochrome C peroxidase (Protein is coded in complementary strand; from 9869730 to 9868456)