Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9847098
End position: 9847121
Length: 24

DNA sequence
>NC_021658, from 9847098 to 9847121 (24 bp); Sorangium cellulosum So0157-2 CCCCCGCCCGCGGCCCCGCCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9846770-9853153	Sequence	SCE1572_34635 - hypothetical protein (Protein is coded in complementary strand; from 9853153 to 9846770)