Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9845129
End position: 9845152
Length: 24

DNA sequence
>NC_021658, from 9845129 to 9845152 (24 bp); Sorangium cellulosum So0157-2 CCCCCGCCCGCGGCCCCGCCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9844822-9846204	Sequence	SCE1572_34630 - hypothetical protein (Protein is coded in complementary strand; from 9846204 to 9844822)