Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9828148
End position: 9828171
Length: 24

DNA sequence
>NC_021658, from 9828148 to 9828171 (24 bp); Sorangium cellulosum So0157-2 CGTTGCGGTTGCCGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9827783-9828187	Sequence	SCE1572_34575 - hypothetical protein (Protein is coded in complementary strand; from 9828187 to 9827783)