Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9813422
End position: 9813484
Length: 63

DNA sequence
>NC_021658, from 9813422 to 9813484 (63 bp); Sorangium cellulosum So0157-2 CGGCCGGCGGCTCCGGCGCCTCGTCCAGCGGCTCCAGCGCGTCGGCCGGCGGCGCCGGGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9813181-9813585	Sequence	SCE1572_34515 - hypothetical protein (Protein is coded in complementary strand; from 9813585 to 9813181)