Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9810975
End position: 9810999
Length: 25

DNA sequence
>NC_021658, from 9810975 to 9810999 (25 bp); Sorangium cellulosum So0157-2 CGCGGCGGGGCGGGGAGCGGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9810426-9812840	Sequence	SCE1572_34510 - hypothetical protein (Protein is coded in complementary strand; from 9812840 to 9810426)