Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9785182
End position: 9785235
Length: 54

DNA sequence
>NC_021658, from 9785182 to 9785235 (54 bp); Sorangium cellulosum So0157-2 CGCCGCAGCGGCGGACGGCGCCGCAGCGGCGGACGGCGCCGCAGCGGCGGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9785138-9785887	Sequence	SCE1572_34445 - hypothetical protein (Protein is coded in complementary strand; from 9785887 to 9785138)