Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9710506
End position: 9710530
Length: 25

DNA sequence
>NC_021658, from 9710506 to 9710530 (25 bp); Sorangium cellulosum So0157-2 CCCCGACCCGCGCCGCCGCGCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9709842-9710954	Sequence	SCE1572_34145 - hypothetical protein (Protein is coded in complementary strand; from 9710954 to 9709842)