Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9709507
End position: 9709530
Length: 24

DNA sequence
>NC_021658, from 9709507 to 9709530 (24 bp); Sorangium cellulosum So0157-2 CGCCGCCCCCGCCGCCCCCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9708462-9709670	Sequence	SCE1572_34140 - hypothetical protein (Protein is coded in complementary strand; from 9709670 to 9708462)