Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9696640
End position: 9696684
Length: 45

DNA sequence
>NC_021658, from 9696640 to 9696684 (45 bp); Sorangium cellulosum So0157-2 GGCGCCGATGTCGCCGTCGCCGATGTCGCCGTCGCCGATGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9694937-9696829	Sequence	SCE1572_34090 - hypothetical protein (Protein is coded in complementary strand; from 9696829 to 9694937)