Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 963374
End position: 963433
Length: 60

DNA sequence
>NC_021658, from 963374 to 963433 (60 bp); Sorangium cellulosum So0157-2 CGCCGGCCGCCGCACCGCCGGCCGATGCGCCGCCGGCCGCCGCGCCGCCGGCCGACGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 962316-963452	Sequence	SCE1572_03600 - hypothetical protein (Protein is coded in complementary strand; from 963452 to 962316)